J Clin Pharmacol
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Heeswijk, R. P. G.
Right arrow Articles by Cameron, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Heeswijk, R. P. G.
Right arrow Articles by Cameron, D. W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

DRUG INTERACTIONS

Time-Dependent Interaction Between Lopinavir/Ritonavir and Fexofenadine

Rolf P. G. van Heeswijk, PharmD, PhD, Marc Bourbeau, BSc, Pearl Campbell, MSc, Isabelle Seguin, Bobby M. Chauhan, BSc, Brian C. Foster, PhD and D. William Cameron, MD

From the Ottawa Hospital, Division of Infectious Diseases (Dr van Heeswijk, Ms Seguin, Dr Cameron) and Department of Pharmacy (Dr van Heeswijk); The Ottawa Health Research Institute (Dr van Heeswijk, Mr Bourbeau, Ms Campbell, Dr Cameron); Ottawa Genome Center (Ms Campbell); University of Ottawa (Mr Chauhan, Dr Foster, Dr Cameron), Ottawa, Ontario, Canada.

Address for reprints: Rolf P. G. van Heeswijk, PharmD, PhD, Tibotec BVBA, Gen De Wittelaan L11B3, 2800 Mechelen, Belgium; e-mail: rvheesw1{at}tibbe.jnj.com.


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
This study investigated the effect of single-dose and steady-state lopinavir/ritonavir on the exposure to fexofenadine, as a measure of P-glycoprotein activity. Sixteen volunteers (8 women) received single-dose oral fexofenadine 120 mg alone, in combination with single-dose ritonavir 100 mg or lopinavir/ritonavir 400/100 mg (randomized 1:1, stratified by sex), and in combination with steady-state lopinavir/ritonavir 400/100 mg twice daily. Single-dose ritonavir and lopinavir/ritonavir increased the area under the fexofenadine plasma concentration-time curve from 0 to infinity (AUC{infty}) by 2.2- and 4.0-fold, respectively (P < .02). Steady-state lopinavir/ritonavir increased the fexofenadine AUC{infty} by 2.9-fold. No changes were observed in the fexofenadine elimination half-life (P > .12). The fexofenadine AUC{infty} was increased by lopinavir/ritonavir, likely due to increased bioavailability secondary to P-glycoprotein inhibition. After repeated administration of lopinavir/ritonavir, the interaction was attenuated compared to the single-dose effect, although a net inhibitory effect was maintained. Time-dependent inhibition of P-glycoprotein by lopinavir/ritonavir should be considered when P-glycoprotein substrates are coadministered.

Key Words: HIVprotease inhibitorsP-glycoproteinlopinavirfexofenadine


Carrier-mediated drug transport is increasingly recognized as an important factor in the disposition of a growing number of drugs. The multidrug efflux transporter P-glycoprotein, a member of the adenosine triphosphate (ATP) binding cassette family encoded by the ABCB1 gene, is expressed in various body tissues, including the apical surface of intestinal enterocytes, the canalicular membrane of hepatocytes, the renal proximal tubules, and endothelial cells in the blood-brain barrier, may thus influence substrate absorption, distribution, and elimination.1 P-glycoprotein transports a wide range of structurally unrelated compounds, including HIV protease inhibitors.2 In addition to being substrates, some of the protease inhibitors are inhibitors of P-glycoprotein, which may contribute to clinically relevant drug-drug interactions.3 The HIV protease inhibitor ritonavir showed P-glycoprotein-modulating properties comparable to the established P-glycoprotein inhibitors cyclosporin A and verapamil in vitro and even more potent than the specific P-glycoprotein inhibitor SDZ PSC 833.4-6 Furthermore, a study in rats showed that repeated oral administration of ritonavir induced the enteric expression of P-glycoprotein by 2.8-fold.7

The inhibitory effect of ritonavir on P-glycoprotein was recently confirmed in 2 interaction studies of repeated administration of ritonavir and single-dose digoxin, a well-established P-glycoprotein substrate, in healthy volunteers.8,9 Ritonavir inhibited the renal clearance of intravenously administered digoxin by 35%, possibly by inhibition of P-glycoprotein in the renal tubules.8 A study with orally administered digoxin, however, did not find an effect on its renal clearance. Instead, the observed 25% increase in systemic digoxin exposure was attributed to inhibition of P-glycoprotein in the canalicular membrane of the hepatocytes, thus reducing the biliary excretion of digoxin.9 As the latter study used a formulation with near-complete bioavailability of digoxin (F > 90%), the combined effect of P-glycoprotein inhibition by ritonavir at the level of the intestines and the liver on substrate bioavailability has yet to be determined.

It has been shown that the HIV protease inhibitor lopinavir also influences P-glycoprotein activity in vitro.10 Similar to ritonavir, acute exposure to lopinavir inhibited P-glycoprotein in Caco-2 cells, whereas chronic exposure resulted in an up to 3-fold increase in the P-glycoprotein activity.10 Lopinavir is widely used for the treatment of antiretroviral naive and experienced HIV-1-infected patients and is coformulated with low-dose ritonavir to enhance its pharmacokinetics (lopinavir/ritonavir 133/33 mg per capsule).11,12

The biphasic effect of both lopinavir and ritonavir on P-glycoprotein function suggests a potential for complex, time-dependent drug-drug interactions with P-glycoprotein substrates. The effect of simultaneous administration of lopinavir and ritonavir on P-glycoprotein activity in vivo, however, has not yet been reported. Therefore, this study was designed to investigate the effect of single-dose ritonavir, as well as both single-dose and steady-state lopinavir/ritonavir, on the activity of P-glycoprotein in healthy volunteers. The study participants were genotyped for a synonymous single-nucleotide polymorphism (SNP) in exon 26 of the ABCB1 gene (C3435T), which has been associated with functional changes in P-glycoprotein activity.13

The systemic exposure to oral fexofenadine was used as a surrogate marker for P-glycoprotein function. Fexofenadine is a nonsedating H1-receptor antagonist used for the treatment of seasonal allergies and is an established substrate for P-glycoprotein.14 Fexofenadine is an attractive in vivo probe substrate because it is largely excreted unchanged into the urine (± 12%) and feces (± 80%) with negligible metabolism (< 5%), and it is safe for use in healthy subjects in doses up to 800 mg.15,16 Fexofenadine has been used in previous studies of P-glycoprotein modulation by, among others, rifampin, St. John's wort, and verapamil.17-19


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Patients and Ethics
Sixteen healthy Caucasian volunteers (8 men, 8 women) were included in this study. The mean ± SD age, weight, and body mass index (calculated as weight/height2) was 33.8 ± 10.0 years (range, 19-48 years), 76.2 ± 13.5 kg (range, 55.4-101.5 kg), and 24.9 ± 2.4 kg/m2 (range, 21.6-29.4 kg/m2), respectively. Subjects were considered healthy based on their medical history, physical examination, routine clinical chemical and hematological tests, and a negative HIV, HBV, and HCV screening. Female subjects of childbearing potential were required to use a barrier method of contraception throughout the study period. All subjects were nonsmokers and abstained from drugs (including over-the-counter drugs, herbal medicines, and vitamins) during the last 2 weeks prior to the start of the study and until the end of the study. Subjects were asked to abstain from oranges/orange juice and grapefruit/grapefruit juice starting 1 week prior to the study and until the end of the study. Alcohol and caffeine-containing foods and beverages were prohibited starting 48 hours prior to each study visit and during study visits. The study protocol was approved by the Ottawa Hospital Research Ethics Board, and written informed consent was obtained from all participants before enrollment in the study.

Study Design and Assessments
This longitudinal study involved 3 pharmacokinetic sampling days (PK days) and was conducted in the Clinical Investigation Unit at the Ottawa Hospital/Ottawa Health Research Institute. The pharmacokinetics of fexofenadine alone was assessed on PK day 1, in combination with single-dose ritonavir or lopinavir/ritonavir on PK day 2, and in combination with steady-state lopinavir/ritonavir on PK day 3.

All subjects received a single oral dose of 120 mg fexofenadine (fexofenadine hydrochloride; Allegra® 60 mg tablets, Aventis Pharma, Inc, Laval, Quebec, Canada) in the morning on PK days 1, 2, and 3 with 250 mL of water after an overnight fast. Blood samples for analysis of fexofenadine concentrations were obtained in ethylenediaminetetraacetic acid-containing tubes by an indwelling catheter or venipuncture just before and at 0.5, 1, 2, 2.5, 3, 3.5, 4, 6, 8, 12, and 24 hours after ingestion of fexofenadine on all study days. Plasma was isolated by centrifugation and stored at -80°C until analysis.

On PK day 2 (72 hours after administration of fexofenadine on PK day 1), subjects were randomized (1:1) to receive a single oral dose of 100 mg ritonavir (Norvir®, Abbott Laboratories, Chicago) or a single oral dose of lopinavir/ritonavir 400/100 mg (Kaletra®, Abbott Laboratories, Chicago), stratified by sex. The next day, all subjects started selfadministration of lopinavir/ritonavir 400/100 mg twice daily for a total of 11 days. On the 12th day, subjects returned to the clinic (PK day 3). Adherence with intake of study medication was assessed by medication diary review and pill count on PK day 3.

On PK days 2 and 3, the protease inhibitors were ingested with 250 mL of water after an overnight fast, followed by fexofenadine 1 hour later. Blood samples for analysis of lopinavir and/or ritonavir concentrations were obtained in heparinized tubes by an indwelling catheter or venipuncture just before and at 1, 2, 3, 4, 6, 8, and 12 hours after ingestion of study drugs. On all pharmacokinetic sampling days, a standardized breakfast was served 2 hours after ingestion of fexofenadine (800 kCal, 25% from fat).

ABCB1 Genotyping
An ethylenediaminetetraacetic acid-blood sample was obtained for isolation of genomic DNA from 2 mL of whole blood, using the QIAamp DNA Blood Midi Kit according to the manufacturer's instructions (Qiagen, Inc, Valencia, Calif). Samples were stored at -80°C until analysis of the single-nucleotide polymorphism in exon 26 of the ABCB1 gene (C3435T). Genomic DNA was quantitated by UV spectophotometry. The resulting genomic DNA for each sample was amplified using primers that spanned the single-nucleotide polymorphism. Primers were designed based on RefSeq NM_000927 for ABCb1 using Vector NTI software (Invitrogen, Carlsbad, Calif). Primer sequences used were as follows: ABCB1 exon 26F TGCTTGATGGCAAAGAAATAAA; ABCB1 exon 26R AGTGACTCGATGA AGGCATGTA. Amplification was performed in the presence of 1 x PCR buffer without magnesium 0.2 mM dNTP mixture, 1.5 mM MgCL2, 0.2 µM each forward and reverse primer, 1 unit of Platinum Taq DNA Polymerase (all from Invitrogen, Carlsbad, Calif), and 40 ng of genomic DNA, at a final total reaction volume of 50 µL. Amplification was performed in a Tetrad Thermocycler (BioRad, Waltham, Mass), and cycling conditions included an initial denaturation for 5 minutes at 96°C followed by 30 cycles of 96°C for 30 seconds, 60°C for 45 seconds, and 72°C for 30 seconds. The terminal elongation was performed at 72°C for 5 minutes. Subsequent to amplification, the products were run on a 1% agarose gel to confirm amplification and correct size (208 bp) of amplicon. The bands were excised, and amplicons were extracted from the agarose gel by the use of the Qiaquick Gel Extraction Kit (Qiagen, Valencia, Calif) according to manufacturer's recommended protocol.

The purified amplicons were sequenced on a 3730 (Applied Biosystems, Foster City, Calif) using Big Dye Terminator v3.1 according to the recommended protocol. Removal of unincorporated fluorescent dyes was achieved by the use of CleanSeq Magnetic Bead Purification (AgenCourt, Beverly, Mass). Elution of the purified sequencing products was performed in water, and the products were loaded directly onto the 3730 for sequence detection. Basecalling and sequence analysis was performed with Seq Analysis 5.1 (Applied Biosystems, Foster City, Calif). The resulting sequences were uploaded into Vector NTI, and alignments to ABCb1 sequence NM_000927 were performed to generate the single-nucleotide polymorphism calls.

Bioanalytical Methods
Concentrations of lopinavir and ritonavir in plasma were measured simultaneously by sensitive and selective, validated high-performance liquid chromatography (HPLC) coupled to tandem mass spectroscopy (LC/MS/MS) at the Ottawa Hospital (Ottawa, ON, Canada). Analytical reference standards for lopinavir and ritonavir were obtained from Abbott Laboratories (Chicago). All samples from a single subject were analyzed in 1 analytical run. Briefly, samples were thawed and the analytes were extracted from 250 µL of plasma by liquid-liquid extraction with 5 mL methyl-tert-butyl-ether after addition of 2 mL ammonium hydroxide 2.5% and dimethyl-dipyridylquinoxaline (internal standard). The organic extract was evaporated to dryness under a gentle stream of nitrogen at 40°C, and the residue was dissolved in 300 µL of freshly prepared n-hexane/methanol/acetonitrile (10/25/25 v/v/v). Aliquots of 10 µL were injected for LC/MS/MS analysis. Chromatographic separation was performed on a Supelcosil® ABZ+-plus column (150 x 4.6 mm, Supelco, Bellefonte, Pa) with isocratic elution using a mixture of 5 mM ammonium hydroxide buffer (pH 4.15)/methanol/acetonitrile (30/35/35 v/v/v) on a HP1100 series HPLC system (Agilent Technologies, Palo Alto, Calif). Detection of lopinavir and ritonavir was carried out by electrospray ionization mass spectrometry on an API2000 triple quadrupole mass spectrometer (Applied Biosystems, Foster City, Calif). Lopinavir and ritonavir were detected by positive-mode multiple-reaction monitoring using the reactions 628.8 to 429.4 m/z and 720.9 to 296.2 m/z, respectively. The calibration curve ranged from 25 ng/mL to 10 000 ng/mL for both analytes and was fitted to a quadratic regression model weighted by 1/concentration. Concentrations above 10 000 ng/mL were reanalyzed after dilution with drug-free human plasma. The intra- and interassay variability for both lopinavir and ritonavir at low (100 ng/mL), medium (3000 ng/mL), and high concentrations (7500 ng/mL) was less than 11.9% and 7.6%, respectively, as determined from analysis of 6 quality control samples at each concentration in 4 batches (total of 24 samples per concentration).

Plasma fexofenadine concentrations were measured by LC/MS/MS at ABR (a Division of Cantest Ltd, Vancouver, BC, Canada). Samples from a single subject were analyzed in 1 analytical run. Briefly, fexofenadine and internal standard (d6-fexofenadine) were extracted from 200 µL of plasma by protein precipitation with 2 mL of acetonitrile after acidification with 0.2 mL of 1% formic acid. Then, 20 µL of the supernatant was injected for LC/MS/MS analysis. Chromatographic separation was performed on a C18 Zorbax Eclipse column (4.6 x 50 mm, 3.5 µm; Agilent Technologies, Palo Alto, Calif) with gradient elution using 0.01% trifluoric acid in H2O and 0.01% trifluoric acid in acetonitrile on a HP1100 series HPLC system (Agilent Technologies, Palo Alto, Calif). Detection of fexofenadine and internal standard was carried out by positive-mode multiple-reaction monitoring using the reactions 502.3 to 466.2 m/z for fexofenadine and 508.2 to 472.3 m/z for the internal standard on a API4000 triple quadrupole mass spectrometer (Applied Biosystems, Foster City, Calif). The calibration curve ranged from 1.00 ng/mL to 600 ng/mL and was fitted to a linear regression model weighted by 1/concentration2. Concentrations above 600 ng/mL were reanalyzed after dilution with drug-free human plasma. The intra- and interassay variability at low (3.00 ng/mL), medium (300 ng/mL), and high (500 ng/mL) fexofenadine concentrations was less than 7.5% and 8.8%, respectively, as determined from analysis of 3 or 4 quality-control samples at each concentration in 8 batches (total of 26 quality control samples per concentration).

Pharmacokinetic Analysis
The plasma concentration (C) versus time (t) data for lopinavir, ritonavir, and fexofenadine were analyzed with standard noncompartmental methods using WinNonlin Pro (version 4.0, Pharsight Corp, Cary, NC). The highest observed plasma concentration was defined as Cmax, with the corresponding sampling time as tmax. The elimination rate constant ({lambda}z) was determined by least squares linear regression analysis (log C vs t) of at least the last 3 measurable plasma concentrations in the elimination phase of the concentration-time profile. The plasma elimination half-life (t1/2) was calculated as ln(2)/{lambda}z. For fexofenadine, the area under the plasma concentration versus time curve from 0 to the last measurable concentration (AUClast) was calculated using the linear-linear trapezoidal rule, with extrapolation to infinity (AUC{infty} = AUClast + (Clast/{lambda}z)). Residual area ranged from 1.0% to 7.7%. For lopinavir and ritonavir, the AUC from 0 to 12 hours postdose was calculated using the linearlinear trapezoidal rule (AUC0-12 h). The apparent oral clearance (Cl/F, where F represents the oral bioavailability) was calculated as dose/AUC, and the volume of distribution (V/F) was calculated as (Cl/F)/{lambda}z.

Statistical Analysis
The pharmacokinetic parameters of fexofenadine after administration of single-dose fexofenadine alone were compared with the results after coadministration of the HIV protease inhibitors using the Wilcoxon signed-rank test. A P value ≤.05 was considered to be statistically significant in all analyses. Furthermore, geometric mean ratios (GMRs) and 95% confidence intervals (95% CI) were calculated for the AUC{infty} and Cmax of fexofenadine (calculated as the ratio of fexofenadine in combination with protease inhibitors to fexofenadine alone; PK day 2 vs PK day 1 to assess the single-dose interaction and PK day 3 vs PK day 1 to assess the steady-state interaction). Pharmacokinetic parameters are presented as the median with interquartile range (IQR). Subjects were genotypically classified into 3 groups based on their ABCB1 genotype at position 3435: subjects homozygous for cytosine (CC), homozygous for thymine (TT), or heterozygous for the mutant allele (CT). As this study was not powered to detect differences in the pharmacokinetics of fexofenadine between the different ABCB1 genotypes, only descriptive statistics were used for these results. Statistical calculations were performed with SPSS for Windows, version 11.0 (SPSS Inc, Chicago).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
All subjects completed the study without serious adverse events. No adverse events were reported after single-dose administration of fexofenadine alone. Diarrhea related to administration of the protease inhibitors was the most common adverse event reported by 12/16 (75%) of the subjects. Diarrhea was classified as mild and moderate intensity for 8 (67%) and 4 subjects (33%), respectively, and did not require intervention. Other adverse events related to study medication include metallic taste (n = 2), nausea (n = 2), vomiting (n = 1), and upset stomach (n = 1). Except for single doses of acetaminophen (n = 1), acetaminophen/methocarbamol (n = 1), ibuprofen (n = 4), and daily oral contraceptives (n = 2), no concomitant oral medication was used during the study period. One subject used daily topical diflucortolone/salicylic acid cream, and another subject used occasional fluticasone nasal spray. There were no significant differences for age, body weight, and body mass index between the subjects randomized to receive single-dose ritonavir versus those randomized to receive single-dose lopinavir/ritonavir on PK day 2 (P > .72). All but 1 subject returned their supply of lopinavir/ritonavir to the clinic on PK day 3. Medication diaries and pill counts showed 100% adherence with intake of study medication between PK day 2 and PK day 3.

Pharmacokinetics
The mean plasma fexofenadine concentration versus time profiles on PK days 1, 2, and 3 are shown in Figure 1. The pharmacokinetic parameters of fexofenadine and the GMRs are summarized in Table 1. The median (IQR) fexofenadine AUC{infty} and Cmax on PK day 1 (ie, single-dose fexofenadine alone) was 1568 h·ng/mL (1355-2068 h·ng/mL) and 289 ng/mL (213-365 ng/mL), respectively. Single-dose coadministration of ritonavir 100 mg increased both the fexofenadine AUC{infty} and Cmax by about 2-fold, based on the GMRs of these parameters (n = 8, P < .02). Single-dose coadministration of lopinavir/ritonavir 400/100 mg increased both the fexofenadine AUC{infty} and Cmax by about 4-fold, based on the GMRs of these parameters (n = 8, P < .02). The difference between the magnitude of the effect of single-dose ritonavir versus single-dose lopinavir/ritonavir on the AUC{infty} and Cmax of fexofenadine was statistically significant (P < .01). Coadministration of steady-state lopinavir/ritonavir 400/100 mg twice daily increased both the fexofenadine AUC{infty} and Cmax by about 3-fold compared to baseline (n = 16, P < .001). The fexofenadine V/F and Cl/F were reduced proportionally after both single-dose and steady-state coadministration of the HIV protease inhibitors, resulting in no significant changes in the terminal elimination half-life of fexofenadine (Table I, P > .12). Furthermore, there was no significant change in the fexofenadine tmax after single-dose or steady-state coadministration of HIV protease inhibitors (P > .20).


Figure 1
View larger version (14K):
[in this window]
[in a new window]
 
Figure 1. Mean plasma fexofenadine concentration versus time profiles in healthy volunteers after oral administration of single-dose 120 mg fexofenadine (FXF) alone (closed circles; n = 16), in combination with single-dose ritonavir (RTV) 100 mg (closed triangles; n = 8), in combination with single-dose lopinavir/ritonavir (LPV/r) 400/100 mg (open triangles; n = 8), and in combination with steady-state LPV/r 400/100 mg (open circles; n = 16).

 

View this table:
[in this window]
[in a new window]
 
Table I Median and Interquartile Range (IQR) of the Fexofenadine Pharmacokinetic Parameters After Single-Dose Oral Administration of Fexofenadine 120 mg to Healthy Volunteers

 

In subjects who received a single dose of ritonavir and lopinavir/ritonavir on PK day 2, respectively, an increase and decrease in the fexofenadine AUC{infty} was observed after steady-state administration of lopinavir/ritonavir compared to the results after single-dose coadministration (Figure 2). The GMR (95% CI) of the fexofenadine AUC{infty} (PK day 3 vs PK day 2) was 1.19 (0.93-1.52) for subjects who received single-dose ritonavir and 0.82 (0.60-1.10) for subjects who received single-dose lopinavir/ritonavir. Similar changes were observed for the fexofenadine Cmax (data not shown). These changes, however, did not reach statistical significance (P > .07).


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
Figure 2. Individual fexofenadine AUC{infty} values (closed circles) after single-dose administration of fexofenadine alone (pharmacokinetic [PK] day 1), in combination with single-dose ritonavir or lopinavir/ritonavir (PK day 2), and in combination with steady-state lopinavir/ritonavir (PK day 3). The left and right panels show the results for subjects who received single-dose lopinavir/ritonavir (LPV/r, n = 8) and single-dose ritonavir (RTV, n = 8), respectively, on PK day 2. The horizontal lines indicate the median fexofenadine AUC{infty} on each study day.

 
The magnitude of the increase in fexofenadine Cmax after single-dose coadministration of either ritonavir or lopinavir/ritonavir was inversely correlated with the baseline fexofenadine Cmax as measured on PK day 1 (P < .03; Figure 3). There was no significant correlation with the baseline fexofenadine AUC{infty} (P > .12).


Figure 3
View larger version (9K):
[in this window]
[in a new window]
 
Figure 3. Relationship between the fexofenadine Cmax after single-dose administration of fexofenadine alone to healthy volunteers (baseline) and the fold-change in the fexofenadine Cmax after coadministration of single-dose ritonavir (open circles, dotted line; y = 4.12 bullet e-0.0018, r2 = 0.61, P = .022) or lopinavir/ritonavir (closed circles, solid line; y = 9.09 bullet e-0.0029, r2 = 0.71, P = .008).

 

There was no difference between men and women in the fexofenadine AUC{infty} or Cmax after single-dose administration of fexofenadine alone (P > .51) or in the magnitude of the effect of coadministration of steady-state lopinavir/ritonavir on these pharmacokinetic parameters (P > .57).

The single-dose and steady-state pharmacokinetic parameters of ritonavir and lopinavir are summarized in Table II. Changes in fexofenadine AUC{infty} or Cmax were not related to the exposure to the protease inhibitors (measured as AUC0-12 h or Cmax) after single-dose or steady-state coadministration (P > .26).


View this table:
[in this window]
[in a new window]
 
Table II Median and Interquartile Range (IQR) of the Ritonavir and Lopinavir Pharmacokinetic Parameters After Single-Dose and Steady-State Administration to Healthy Volunteers, in Combination With Single-Dose Fexofenadine 120 mg

 

ABCB1 Genotyping
Twelve subjects were heterozygous at position 3435 (CT), 3 were homozygous for the 3435CC allele, and 1 was homozygous for the 3435TT allele. The fexofenadine AUC{infty} and Cmax after single-dose administration of fexofenadine alone in the homozygous subjects were comparable to the observations for the heterozygous subjects. The fexofenadine Cmax was, respectively, 329, 377, and 618 ng/mL for the three 3435CC subjects and 298 ng/mL for the 3435TT subject. The median (range) fexofenadine Cmax for the 3435CT subjects was 259 ng/mL (149-594 ng/mL).


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
In the current study, we observed a 2.2-fold and 4.0-fold increase in the systemic exposure to fexofenadine (AUC{infty} and Cmax) after single-dose coadministration of ritonavir or lopinavir/ritonavir, respectively. After 12 days' administration of lopinavir/ritonavir 400/100 mg twice daily, the initial effect of single-dose lopinavir/ritonavir was attenuated (although not statistically significant), resulting in an average 2.9-fold increase in fexofenadine exposure compared to baseline. Single-dose or steady-state coadministration of the HIV protease inhibitors did not affect the elimination half-life of fexofenadine. The observed changes in the pharmacokinetics of fexofenadine are consistent with an increased bioavailability rather than a reduced elimination. The lack of an exposure-response relationship between the pharmacokinetics of lopinavir and ritonavir and the magnitude of the interaction with fexofenadine suggest that a maximum effect was achieved in all subjects.

Increased systemic exposure to fexofenadine can be explained by inhibition of P-glycoprotein at the level of the intestine, the liver, and the kidneys. Previous studies of P-glycoprotein modulation with ritonavir showed conflicting results with regards to the effect on P-glycoprotein in the renal tubules.8,9 One study reported a 35% reduction in the renal clearance of the P-glycoprotein substrate digoxin, whereas another study did not find such an effect. Although renal excretion of fexofenadine was not measured in the current study, it was previously shown that only about 10% to 15% of a 120-mg fexofenadine dose is excreted into the urine.19,20 As the oral bioavailability of fexofenadine has been estimated to be at least 33%, even complete inhibition of the renal excretion of fexofenadine in the presence of lopinavir and ritonavir cannot explain the more than 2-fold increase in systemic exposure observed in our study.21 Furthermore, the lack of an effect on fexofenadine elimination half-life suggests that inhibition of first-pass metabolism is more likely to be the primary mechanism of this interaction. This is consistent with data suggesting that the P-glycoprotein inhibitor verapamil increased the bioavailability of fexofenadine without influencing its renal excretion.19

It has previously been shown that the P-glycoprotein inhibitor verapamil did not significantly affect the jejunal permeability for fexofenadine in healthy volunteers, suggesting minimal impact of intestinal P-glycoprotein on fexofenadine absorption.22 Because intestinal transport was unchanged, the observed 4-fold increase in the systemic fexofenadine AUC during combination with verapamil was explained by either decreased uptake by organic anion transporting polypeptide (OATP) into the hepatocytes and/or P-glycoprotein-mediated canalicular secretion of fexofenadine into the bile.22 Further evidence of the limited influence of intestinal P-glycoprotein on the absorption of fexofenadine can be inferred from the dose-proportional pharmacokinetics over a wide dose range from 10 to 800 mg.20 Transport studies of fexofenadine over a Caco-2 cell monolayer suggest saturation of efflux transport at increasing concentrations.23 In addition, fexofenadine exposure was similarly increased (ie, 4.6-fold) after intravenous and oral administration to P-glycoprotein knockout mice as compared to wild-type animals, suggesting no effect of intestinal P-glycoprotein on the oral availability of fexofenadine.14 Together, these findings indicate that the significant interaction in the current study may occur predominantly at the level of first-pass liver extraction as opposed to intestinal absorption. This is in agreement with a study of single-dose ritonavir 600 mg and the P-glycoprotein substrate loperamide in healthy volunteers, which did not find evidence to suggest inhibition of intestinal P-glycoprotein by ritonavir.24

An effect of lopinavir or ritonavir on drug transporters other than P-glycoprotein should be considered, as fexofenadine is also a substrate of a family of uptake transporters encoded by the SLCO gene (ie, OATPs), which are expressed in multiple organs, often colocalized with P-glycoprotein, including the intestines and the liver.14 In the apical membrane of the intestinal enterocytes, OATP enhances substrate absorption, whereas OATP in the basolateral membrane of the hepatocytes facilitates intracellular uptake for subsequent metabolism by cytochrome P450 isoenzymes or biliary excretion by P-glycoprotein.22 A recent study reported an association between a polymorphism in the SLCO1B1 gene and fexofenadine pharmacokinetics, confirming the role of the hepatic uptake transporter OATP1B1 in fexofenadine disposition.25 Although data on the effect of lopinavir on OATP function are lacking, ritonavir has been shown to be an inhibitor of OATP-mediated uptake in vitro.14 Inhibition of OATP by fruit juices in vivo reduced the fexofenadine AUC by 60% to 70%, without an effect on renal clearance, suggesting an effect on oral bioavailability.26 However, because we observed a marked increase in fexofenadine bioavailability, a significant effect of lopinavir and ritonavir on intestinal OATP-mediated uptake of fexofenadine by the enterocytes is unlikely. Furthermore, in vitro studies showed that ritonavir at a concentration of 671 ng/mL inhibited OATP-mediated uptake of fexofenadine by a mean of only 13% (SD 6.9%).14 In the current study, the ritonavir Cmax was well below this concentration after both single-dose and steady-state coadministration for the majority of subjects (Table II). Thus, the potential contribution of OATP modulation by lopinavir and ritonavir on the net outcome of the interaction with fexofenadine is likely insignificant. In addition, ritonavir has been shown to be an in vitro inhibitor of multidrug resistance-associated protein 2 (MRP2) and breast cancer resistance protein (BCRP), which function as efflux transporters in various tissues, including the intestines, liver, and kidney, and are expressed in greater amounts than P-glycoprotein.4,27,28 Although some degree of overlapping substrate specificity with P-glycoprotein has been suggested, the role of MRP2 and BCRP in the disposition of fexofenadine remains to be established.28

We observed an inverse exponential relationship between the fexofenadine Cmax at baseline and the magnitude of the interaction after coadministration of lopinavir/ritonavir and ritonavir. As a result, subjects with a low exposure to fexofenadine at baseline showed the largest increase in fexofenadine exposure after coadministration of the HIV protease inhibitors. A low exposure to fexofenadine at baseline can be explained by high activity of P-glycoprotein, making these subjects more susceptible to the effects of P-glycoprotein inhibitors (Figure 3). Although this relationship is biologically plausible and similar observations have been reported before, an arithmetical artifact cannot be completely excluded. Previous studies reported an association between ABCB1 polymorphism and the oral availability of fexofenadine and other P-glycoprotein substrates, but this has not been consistent across studies.29,30 In our small study, we could not assess the effect of the synonymous SNP in exon 26 (C3435T) of the ABCB1 gene on the pharmacokinetics of fexofenadine. Larger studies, evaluating haplotype relationships, are required to further investigate the pharmacogenomics of fexofenadine.

The effect of lopinavir/ritonavir on the AUC{infty} and Cmax of fexofenadine was attenuated after repeated administration compared to the single-dose effect (a 2.9-fold vs 4.0-fold change, respectively), although this did not reach statistical significance (P = .12). A similar time-dependent effect of ritonavir on CYP3A4-mediated metabolism has previously been reported. The short-term effect of coadministration of ritonavir 200 mg and the CYP3A4-substrate alprazolam was inhibition of the oral alprazolam clearance by 59%, whereas administration of ritonavir at a dose titrated upward to 500 mg twice daily over 12 days increased alprazolam clearance by 12%.31 The reduction in the magnitude of the initial interaction between fexofenadine and lopinavir/ritonavir can be explained by upregulation of P-glycoprotein, which has been observed in vitro after prolonged exposure of human intestinal cell lines to either lopinavir or ritonavir.10,32 Transcriptional regulation of ABCB1 as well as CYP3A4 is controlled by the nuclear, ligand-activated steroid and xenobiotic receptor (SXR), also called the pregnaneactivated receptor (PXR), which is highly expressed in the liver and more moderately in the intestines.33,34 Activation of PXR ultimately results in up-regulation of its target genes, including ABCB1, and is likely the underlying molecular mechanism of our observations, as both ritonavir and lopinavir are ligands for PXR.34,35 Our results suggest a moderate induction of P-glycoprotein activity after 12 days of lopinavir/ritonavir 400/100 mg twice daily, although a net inhibitory effect on P-glycoprotein function was maintained. The time course and extent of P-glycoprotein induction beyond the current 12-day study period remains to be investigated. Reduced exposure to the HIV protease inhibitor and P-glycoprotein substrate saquinavir has previously been reported in HIV-1-infected subjects after prolonged treatment with a regimen containing saquinavir/ritonavir 400/400 mg twice daily.36 The pharmacokinetics of saquinavir was assessed 4 to 12 months (median 7 months) after initiating the saquinavir/ritonavir regimen and compared with a second assessment 9 to 15 months later (median 10 months).36 The median saquinavir AUC0-8 h was reduced by 33% (n = 6, P = .06), suggesting the possibility of continued induction of P-glycoprotein after the 12-day period evaluated in the current study.

In summary, both ritonavir and lopinavir/ritonavir significantly increased systemic exposure to fexofenadine after single-dose coadministration by 2.2- and 4.0-fold, respectively. The changes in the pharmacokinetics of fexofenadine are consistent with an increased oral bioavailability, most likely due to inhibition of hepatic P-glycoprotein, although a contribution of other drug-transporting proteins cannot be excluded. After repeated administration of lopinavir/ritonavir, the magnitude of the interaction was attenuated compared to single-dose coadministration, suggesting induced activity of P-glycoprotein. Timedependent inhibition of P-glycoprotein by lopinavir/ritonavir should therefore be considered when P-glycoprotein substrates are coadministered in HIV-infected individuals. Further studies are warranted to unravel the complex interplay between uptake and efflux transporters at various sites in the human body and the relative impact of their modulation on substrate pharmacokinetics.


    ACKNOWLEDGEMENTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
The authors would like to thank the subjects who participated in this study. Diane Côté is acknowledged for her help with the collection of the blood samples. This study was supported by Abbott Laboratories. RvH is supported by a Scholarship Award from the OHTN (SCH 108), and DWC is supported by a Career Scientist Award from the OHTN.


DOI: 10.1177/0091270006288733

RvH and DWC have received honoraria and research and travel grants unrelated to the current study from Abbott Laboratories.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 

1. Marzolini C, Paus E, Buclin T, Kim RB. Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clin Pharmacol Ther. 2004;75: 13-33.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

2. Huisman MT, Smit JW, Schinkel AH. Significance of P-glycoprotein for the pharmacology and clinical use of protease inhibitors. AIDS. 2000;14: 237-242.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

3. Phillips EJ, Rachlis AR, Ito S. Digoxin toxicity and ritonavir: a drug interaction mediated through P-glycoprotein? AIDS. 2003;17: 1577-1578.[Medline] [Order article via Infotrieve]

4. Gutmann H, Fricker G, Drewe J, et al. Interactions of HIV protease inhibitors with ATP-dependent drug export proteins. Mol Pharmacol. 1999;56: 383-389.[Abstract/Free Full Text]

5. Perloff MD, von Moltke LL, Greenblatt DJ. Fexofenadine transport in Caco-2 cells: inhibition with verapamil and ritonavir. J Clin Pharmacol. 2002;42: 1269-1274.[Abstract]

6. Drewe J, Gutman H, Fricker G, et al. HIV protease inhibitor ritonavir: a more potent inhibitor of P-glycoprotein than the cyclosporine analog SDZ PSC 833. Biochem Pharmacol. 1999;57: 1147-1152.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

7. Perloff MD, von Moltke LL, Greenblatt DJ. Ritonavir and dexamethasone induce expression of CYP3A4 and P-glycoprotein in rats. Xenobiotica. 2004;34: 133-150.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

8. Ding R, Tayrouz Y, Riedel KD, et al. Substantial pharmacokinetic interaction between digoxin and ritonavir in healthy volunteers. Clin Pharmacol Ther. 2004;76: 73-84.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

9. Penzak SR, Shen JM, Alfaro RM, et al. Ritonavir decreases the nonrenal clearance of digoxin in healthy volunteers with known MDR1 genotypes. Ther Drug Monit. 2004;26: 322-330.[CrossRef][Medline] [Order article via Infotrieve]

10. Vishnuvardhan D, von Moltke LL, Richtert C, Greenblatt DJ. Lopinavir: acute exposure inhibits P-glycoprotein; extended exposure induces P-glycoprotein. AIDS. 2003;17: 1092-1094.[CrossRef][Medline] [Order article via Infotrieve]

11. Heeswijk van RPG, Veldkamp AI, Mulder JW, et al. Combination of protease inhibitors for the treatment of HIV-1-infected patients: a review of pharmacokinetics and clinical experience. Antiviral Ther. 2001;6: 201-229.[Web of Science][Medline] [Order article via Infotrieve]

12. Cvetkovic RS, Goa KL. Lopinavir/ritonavir: a review of its use in the management of HIV infection. Drugs. 2003;63: 769-802.[CrossRef][Medline] [Order article via Infotrieve]

13. Hoffmeyer S, Burk O, von Richter O, et al. Functional polymorphism of the multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression in vivo. Proc Natl Acad Sci USA. 2000;97: 3473-3478.[Abstract/Free Full Text]

14. Cvetkovic M, Leake B, Fromm MF, Wilkinson GR, Kim RB. OATP and P-glycoprotein transporters mediate the cellular uptake and excretion of fexofenadine. Drug Metab Dispos. 1999;27: 866-871.[Abstract/Free Full Text]

15. Molimard M, Diquet B, Strolin Beneditti M. Comparison of pharmacokinetics and metabolism of desloratidine, fexofenadine, levocetirizine and mizolastine in humans. Fund Clin Pharmacol. 2004;18: 399-411.[Medline] [Order article via Infotrieve]

16. Robbins DK, Castles MA, Pack DJ, Bhargava VO, Weir SJ. Dose proportionality and comparison of single and multiple dose pharmacokinetics of fexofenadine and its enantiomers in healthy male volunteers. Biopharm Drug Dispos. 1998;19: 455-463.[Medline] [Order article via Infotrieve]

17. Hamman MA, Bruce MA, Haehner-Daniels BD, et al. The effect of rifampin administration on the disposition of fexofenadine. Clin Pharmacol Ther. 2001;69: 114-121.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

18. Dresser GK, Schwarz UI, Wilkinson GR, et al. Coordinate induction of both cytochrome P4503A and MDR1 by St John's wort in healthy subjects. Clin Pharmacol Ther. 2003;73: 41-50.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

19. Yasui-Furukori N, Uno T, Sugawara K, Tateishi T. Different effects of three transporting inhibitors, verapamil, cimetidine, and probenecid, on fexofenadine pharmacokinetics. Clin Pharmacol Ther. 2005;77: 17-23.[CrossRef][Medline] [Order article via Infotrieve]

20. Robbins DK, Castles MA, Pack DJ, Bhargava VO, Weir SJ. Dose proportionality and comparison of single and multiple dose pharmacokinetics of fexofenadine (MDL 16455) and its enantiomers in healthy male volunteers. Biopharm Drug Dispos. 1998;19: 455-463.[Medline] [Order article via Infotrieve]

21. Molimard M, Diquet B, Benedetti MS. Comparison of pharmacokinetics and metabolism of desloratidine, fexofenadine, levocetirizine and mizolastine in humans. Fund Clin Pharmacol. 2004;18: 399-411.

22. Tannergren C, Petri N, Knutson L, Hedeland M, Bondesson U, Lennernas H. Multiple transport mechanisms involved in the intestinal absorption and first-pass extraction of fexofenadine. Clin Pharmacol Ther. 2003;74: 423-436.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

23. Petri N, Tannergren C, Rungstad D, Lennernas H. Transport characteristics of fexofenadine in the Caco-2 cell model. Pharm Res. 2004;21: 1398-1404.[Medline] [Order article via Infotrieve]

24. Tayrouz Y, Ganssmann B, Ding R, et al. Ritonavir increases loperamide plasma concentrations without evidence for P-glycoprotein involvement. Clin Pharmacol Ther. 2001;70: 405-414.[CrossRef][Medline] [Order article via Infotrieve]

25. Niemi M, Kivisto KT, Hofmann U, et al. Fexofenadine pharmacokinetics are associated with a polymorphism of the SCLO1B1 gene (encoding OATP1B1). Br J Clin Pharm. 2005;59: 602-604.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

26. Dresser GK, Bailey DG, Leake BF, et al. Fruit juices inhibit organic anion transporting polypeptide-mediated drug uptake to decrease the oral availability of fexofenadine. Clin Pharmacol Ther. 2002;71: 11-20.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

27. Gupta A, Zhang Y, Unadkat JD, Mao Q. HIV protease inhibitors are inhibitors but not substrates of the human breast cancer resistance protein (BCRP/ABCG2). J Pharmacol Exp Ther. 2004;310: 334-341.[Abstract/Free Full Text]

28. Chan S, Lowes S, Hirst BH. The ABCs of drug transport in intestine and liver: efflux proteins limiting drug absorption and bioavailability. Eur J Pharm Sci. 2004;21: 25-51.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

29. Drescher S, Schaeffler E, Hitzl M, et al. MDR1 gene polymorphisms and disposition of the P-glycoprotein substrate fexofenadine. Br J Clin Pharmacol. 2002;53: 526-534.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

30. Kim RB, Leake BF, Choo EF, et al. Identification of functionally variant MDR1 alleles among European Americans and African Americans. Clin Pharmacol Ther. 2001;70: 189-199.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

31. Greenblatt DJ, von Moltle LL, Harmatz JS, et al. Alprazolamritonavir interaction: implications for product labeling. Clin Pharmacol Ther. 2000;67: 335-341.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

32. Perloff MD, von Moltke LL, Marchand JE, Greenblatt DJ. Ritonavir induces P-glycoprotein expression, multidrug resistance-associated protein (MRP1) expression, and drug transporter-mediated activity in a human intestinal cell line. J Pharm Sci. 2001;90: 1829-1837.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

33. Eloranta JJ, Kullak-Ublick GA. Coordinate transcriptional regulation of bile acid homeostatis and drug metabolism. Arch Biochem Biophys. 2005;433: 397-412.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]

34. Dussault I, Lin M, Hollister K, et al. Peptide mimetic HIV protease inhibitors are ligands for the orphan receptor SXR. J Biol Chem. 2001;276: 33309-33312.[Abstract/Free Full Text]

35. Marzolini C, Tirona RG, Lee W, et al. Unexpected complexity in nuclear receptor activation by HIV protease inhibitors and induction of CYP enzymes and transporters. In: 11th Conference on Retroviruses and Opportunistic Infections; February 8-11, 2004; San Francisco. Abstract 135.

36. Gisolf EH, van Heeswijk RP, Hoetelmans RWM, Danner SA. Decreased exposure to saquinavir in HIV-1-infected patients after long-term antiretroviral therapy including ritonavir and saquinavir. AIDS. 2000;14: 801-805.[CrossRef][Medline] [Order article via Infotrieve]
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
The Annals of PharmacotherapyHome page
M. M Foisy, E. M Yakiwchuk, and C. A Hughes
Induction Effects of Ritonavir: Implications for Drug Interactions
Ann. Pharmacother., July 1, 2008; 42(7): 1048 - 1059.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
A. Gupta, G. M. Mugundu, P. B. Desai, K. E. Thummel, and J. D. Unadkat
Intestinal Human Colon Adenocarcinoma Cell Line LS180 Is an Excellent Model to Study Pregnane X Receptor, but Not Constitutive Androstane Receptor, Mediated CYP3A4 and Multidrug Resistance Transporter 1 Induction: Studies with Anti-Human Immunodeficiency Virus Protease Inhibitors
Drug Metab. Dispos., June 1, 2008; 36(6): 1172 - 1180.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
S. Matsushima, K. Maeda, N. Ishiguro, T. Igarashi, and Y. Sugiyama
Investigation of the Inhibitory Effects of Various Drugs on the Hepatic Uptake of Fexofenadine in Humans
Drug Metab. Dispos., April 1, 2008; 36(4): 663 - 669.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
L. Tong, T. K. Phan, K. L. Robinson, D. Babusis, R. Strab, S. Bhoopathy, I. J. Hidalgo, G. R. Rhodes, and A. S. Ray
Effects of Human Immunodeficiency Virus Protease Inhibitors on the Intestinal Absorption of Tenofovir Disoproxil Fumarate In Vitro
Antimicrob. Agents Chemother., October 1, 2007; 51(10): 3498 - 3504.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (12)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Heeswijk, R. P. G.
Right arrow Articles by Cameron, D. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by van Heeswijk, R. P. G.
Right arrow Articles by Cameron, D. W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS